cf pcmv (Sino Biological)
Sino Biological is a verified supplier 
Sino Biological manufactures this product 
94
Structured Review
Sino Biological
cf pcmv
Cf Pcmv, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cf+pcmv/Human+IRF3%2FIRF-3+Gene+ORF+cDNA+clone+expression+plasmid%2C+C-Flag+tag/pmc09638925__gkac823_supplemental_file-41-32-30
Average 94 stars, based on 1 article reviews
Cf Pcmv, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cf+pcmv/Human+IRF3%2FIRF-3+Gene+ORF+cDNA+clone+expression+plasmid%2C+C-Flag+tag/pmc09638925__gkac823_supplemental_file-41-32-30
Average 94 stars, based on 1 article reviews
cf pcmv - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Recombinant:Article Title: USP15 promotes cGAS activation through deubiquitylation and liquid condensation Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies cGAS (D3O8O) (mouse specific) Cell Signaling Tech 31659S cGAS (D1D3G) Cell Signaling Tech 15102S USP15 Proteintech 14354-1-AP STING/TMEM173 Proteintech 19851-1-AP p-STING (S365) (D8F4W) Cell Signaling Tech 72971S IRF3 (D6I4C) Cell Signaling Tech 11904S p-IRF3 (S396) (4D4G) Cell Signaling Tech 4947S p-TBK1 (S172) (D52C2) Cell Signaling Tech 5483S ENPP1 Abcam ab223268 Ub(K48) Abcam ab140601 Ub(K63) Abcam ab179434 Anti-Flag tag pAb MBL PM020 Anti-Myc tag pAb MBL 562 Anti-HA tag pAb MBL 561 Rabbit IgG (DA1E) Isotype Control Cell Signaling Tech 3900S GAPDH (14C10) Cell Signaling Tech 2118S Alexa Fluor 488 goat anti-mouse IgG (H+L) Invitrogen A11001 Alexa Fluor 488 goat anti-rabbit IgG (H+L) Invitrogen A11034 Alexa Fluor 568 goat anti-mouse IgG (H+L) Invitrogen A11031 Alexa Fluor 568 goat anti-rabbit IgG (H+L) Invitrogen A11011 Bacterial and virus strains VACV Zhengfan Jiang’s laboratory N/A Chemicals, peptides, and recombinant proteins Protease Inhibitor Cocktail Thermo Fisher Scientific Cat#78430 Phosphatase inhibitor Thermo Fisher Scientific Cat#A32957 HT-DNA Sigma Cat#D6898 M-CSF, mouse Sigma Cat#SRP3221 PMA Sigma Cat#P1585 Anti-Myc Magnetic Beads Bimake Cat#B26301 Anti-Flag M2 Magnetic Beads Sigma Cat#M8823 Anti-Flag affinity gel Bimake Cat#B23102 TRIzol Reagent Invitrogen Cat#15596018 Streptavidin Sepharose-R Beads Cell Signaling Tech Cat#3419S Pierce RIPA Buffer Thermo Fisher Scientific Cat#89900 Protein A/G Plus-Agarose Santa Cruz Cat#sc-2003 cGAMP Sigma Cat#SML1299 DAPI Beyotime Cat#C1006 FluoromountTM Aqueous Mounting Medium Sigma Cat#F4680 Critical commercial assays Lipofectamine 3000 Transfection Kit Invitrogen Cat#2145954 HOOK(TM) Dye Labeling Kit (5/6) TAMRA-SE (Rhodamine) Sangon biotech Cat#C006142-0005 HOOK(TM) Dye Labeling Kit (FITC) Sangon biotech Cat#C006141-0005 iScript cDNA synthesis kit Bio-Rad Cat#1706691 iTaq Universal SYBR Green Supermix Bio-Rad Cat#172521 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23225 Fast Mutagenesis System Transgen Cat#FM111 pEASY-Uni Seamless Cloning and Assembly Kit Transgen Cat#CU101 SuperSignalTM West Pico PLUS Substrate Kit Thermo Fisher Scientific Cat#34578 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HeLa NICR (National Infrastructure of Cell Line Resource) N/A .. L929 NICR N/A Vero NICR N/A THP-1 NICR N/A Oligonucleotides (FITC-, Biotin-) ISD (45 bp): TACAGATCTACTAGTGATCTATGACTGATCTGTACAT GATCTACA This paper N/A (FITC-, Biotin-) 100-bp DNA: ACATCTAGTACATGTCTAGTCAGTATCTAGTGATTAT CTAGACATACATCTAGTACATGTCTAGTCAGTATCTA GTGATTATCTAGACATGGACTCATCC Recombinant DNA pCMV3-IRF3-Flag Sino Biological # Software:Article Title: USP15 promotes cGAS activation through deubiquitylation and liquid condensation Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies cGAS (D3O8O) (mouse specific) Cell Signaling Tech 31659S cGAS (D1D3G) Cell Signaling Tech 15102S USP15 Proteintech 14354-1-AP STING/TMEM173 Proteintech 19851-1-AP p-STING (S365) (D8F4W) Cell Signaling Tech 72971S IRF3 (D6I4C) Cell Signaling Tech 11904S p-IRF3 (S396) (4D4G) Cell Signaling Tech 4947S p-TBK1 (S172) (D52C2) Cell Signaling Tech 5483S ENPP1 Abcam ab223268 Ub(K48) Abcam ab140601 Ub(K63) Abcam ab179434 Anti-Flag tag pAb MBL PM020 Anti-Myc tag pAb MBL 562 Anti-HA tag pAb MBL 561 Rabbit IgG (DA1E) Isotype Control Cell Signaling Tech 3900S GAPDH (14C10) Cell Signaling Tech 2118S Alexa Fluor 488 goat anti-mouse IgG (H+L) Invitrogen A11001 Alexa Fluor 488 goat anti-rabbit IgG (H+L) Invitrogen A11034 Alexa Fluor 568 goat anti-mouse IgG (H+L) Invitrogen A11031 Alexa Fluor 568 goat anti-rabbit IgG (H+L) Invitrogen A11011 Bacterial and virus strains VACV Zhengfan Jiang’s laboratory N/A Chemicals, peptides, and recombinant proteins Protease Inhibitor Cocktail Thermo Fisher Scientific Cat#78430 Phosphatase inhibitor Thermo Fisher Scientific Cat#A32957 HT-DNA Sigma Cat#D6898 M-CSF, mouse Sigma Cat#SRP3221 PMA Sigma Cat#P1585 Anti-Myc Magnetic Beads Bimake Cat#B26301 Anti-Flag M2 Magnetic Beads Sigma Cat#M8823 Anti-Flag affinity gel Bimake Cat#B23102 TRIzol Reagent Invitrogen Cat#15596018 Streptavidin Sepharose-R Beads Cell Signaling Tech Cat#3419S Pierce RIPA Buffer Thermo Fisher Scientific Cat#89900 Protein A/G Plus-Agarose Santa Cruz Cat#sc-2003 cGAMP Sigma Cat#SML1299 DAPI Beyotime Cat#C1006 FluoromountTM Aqueous Mounting Medium Sigma Cat#F4680 Critical commercial assays Lipofectamine 3000 Transfection Kit Invitrogen Cat#2145954 HOOK(TM) Dye Labeling Kit (5/6) TAMRA-SE (Rhodamine) Sangon biotech Cat#C006142-0005 HOOK(TM) Dye Labeling Kit (FITC) Sangon biotech Cat#C006141-0005 iScript cDNA synthesis kit Bio-Rad Cat#1706691 iTaq Universal SYBR Green Supermix Bio-Rad Cat#172521 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23225 Fast Mutagenesis System Transgen Cat#FM111 pEASY-Uni Seamless Cloning and Assembly Kit Transgen Cat#CU101 SuperSignalTM West Pico PLUS Substrate Kit Thermo Fisher Scientific Cat#34578 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HeLa NICR (National Infrastructure of Cell Line Resource) N/A .. L929 NICR N/A Vero NICR N/A THP-1 NICR N/A Oligonucleotides (FITC-, Biotin-) ISD (45 bp): TACAGATCTACTAGTGATCTATGACTGATCTGTACAT GATCTACA This paper N/A (FITC-, Biotin-) 100-bp DNA: ACATCTAGTACATGTCTAGTCAGTATCTAGTGATTAT CTAGACATACATCTAGTACATGTCTAGTCAGTATCTA GTGATTATCTAGACATGGACTCATCC Recombinant DNA pCMV3-IRF3-Flag Sino Biological # |